Transcript: Mouse NM_010012.3

Mus musculus cytochrome P450, family 8, subfamily b, polypeptide 1 (Cyp8b1), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp8b1 (13124)
Length:
1950
CDS:
42..1544

Additional Resources:

NCBI RefSeq record:
NM_010012.3
NBCI Gene record:
Cyp8b1 (13124)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247893 TTCAGGAAGTTCCGTCGATTT pLKO_005 645 CDS 100% 10.800 15.120 N Cyp8b1 n/a
2 TRCN0000257684 TTGGTGATGCTAGGGCCTAAA pLKO_005 483 CDS 100% 10.800 15.120 N Cyp8b1 n/a
3 TRCN0000173132 CCGTCGATTTGACTTTCTCTT pLKO.1 656 CDS 100% 4.950 6.930 N Cyp8b1 n/a
4 TRCN0000174718 GATTATGTACTTCGACTTCAA pLKO.1 1409 CDS 100% 4.950 6.930 N Cyp8b1 n/a
5 TRCN0000247894 TCATCCATGCAGGACAAATTT pLKO_005 843 CDS 100% 15.000 10.500 N Cyp8b1 n/a
6 TRCN0000247892 GGGTGGTACAGGAGGATTATG pLKO_005 1111 CDS 100% 13.200 9.240 N Cyp8b1 n/a
7 TRCN0000257776 CATGTGGTCAGCTCAGTTTAC pLKO_005 1707 3UTR 100% 10.800 7.560 N Cyp8b1 n/a
8 TRCN0000064264 CCGGAAGAATATGTTTGAATT pLKO.1 185 CDS 100% 0.000 0.000 N CYP8B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.