Transcript: Mouse NM_010047.4

Mus musculus DiGeorge syndrome critical region gene 6 (Dgcr6), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Dgcr6 (13353)
Length:
1552
CDS:
369..881

Additional Resources:

NCBI RefSeq record:
NM_010047.4
NBCI Gene record:
Dgcr6 (13353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010047.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249885 AGGCTATGGACCGAAAGATTG pLKO_005 688 CDS 100% 10.800 15.120 N Dgcr6 n/a
2 TRCN0000249886 GACGCTGCAGATGAACCTATT pLKO_005 803 CDS 100% 10.800 15.120 N Dgcr6 n/a
3 TRCN0000179708 GATGAACCTATTGGAACTCAT pLKO.1 812 CDS 100% 4.950 6.930 N Dgcr6 n/a
4 TRCN0000249883 CGACGGAACGGTGTTTGAAAT pLKO_005 452 CDS 100% 13.200 9.240 N Dgcr6 n/a
5 TRCN0000249882 TGCCATCCACTGTTCAGATTT pLKO_005 1021 3UTR 100% 13.200 9.240 N Dgcr6 n/a
6 TRCN0000249884 AGTGCTCAGACAGACTCTAAG pLKO_005 554 CDS 100% 10.800 7.560 N Dgcr6 n/a
7 TRCN0000017144 CCAGCAGAGCACACTGGAGAA pLKO.1 737 CDS 100% 1.350 0.945 N DGCR6L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010047.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.