Transcript: Mouse NM_010080.3

Mus musculus dentin sialophosphoprotein (Dspp), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Dspp (666279)
Length:
4440
CDS:
86..2923

Additional Resources:

NCBI RefSeq record:
NM_010080.3
NBCI Gene record:
Dspp (666279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262990 CCACTCAACCAGTGATGATTA pLKO_005 2902 CDS 100% 13.200 10.560 N Dspp n/a
2 TRCN0000262988 TTTCGGGAGGTGGGATCATAT pLKO_005 3660 3UTR 100% 13.200 10.560 N Dspp n/a
3 TRCN0000262989 GATGGTGACAGTGACAGTAAT pLKO_005 1643 CDS 100% 13.200 9.240 N Dspp n/a
4 TRCN0000262992 GGGAATGGCTCCGAGTCAATA pLKO_005 332 CDS 100% 13.200 9.240 N Dspp n/a
5 TRCN0000262991 GATAGGAGAGCAGGTACTTAG pLKO_005 289 CDS 100% 10.800 7.560 N Dspp n/a
6 TRCN0000201619 CCCAGAGTTTCAGAAGAGTTT pLKO.1 4039 3UTR 100% 4.950 3.465 N Dspp n/a
7 TRCN0000202447 GTGTTGAAGAAGGCGACAGTA pLKO.1 1041 CDS 100% 4.950 3.465 N Dspp n/a
8 TRCN0000202073 CCCAGTTAGTACCACTGGAAA pLKO.1 147 CDS 100% 0.495 0.347 N Dspp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.