Transcript: Mouse NM_010095.6

Mus musculus early B cell factor 2 (Ebf2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ebf2 (13592)
Length:
5527
CDS:
970..2697

Additional Resources:

NCBI RefSeq record:
NM_010095.6
NBCI Gene record:
Ebf2 (13592)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010095.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081517 GACAGAATAAGAATCCCGAAA pLKO.1 1394 CDS 100% 4.050 5.670 N Ebf2 n/a
2 TRCN0000081516 GTTCATCTACACAGCCTTAAA pLKO.1 1965 CDS 100% 13.200 9.240 N Ebf2 n/a
3 TRCN0000081513 GCAGCAATTCTTTGTTATGAA pLKO.1 2943 3UTR 100% 5.625 3.938 N Ebf2 n/a
4 TRCN0000081515 CGGCTACAGCAATGTTCCTAT pLKO.1 2409 CDS 100% 4.950 3.465 N Ebf2 n/a
5 TRCN0000081514 GCCTTAAATGAACCCACCATA pLKO.1 1978 CDS 100% 4.950 3.465 N Ebf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010095.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.