Transcript: Mouse NM_010100.3

Mus musculus ectodysplasin-A receptor (Edar), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Edar (13608)
Length:
3697
CDS:
260..1606

Additional Resources:

NCBI RefSeq record:
NM_010100.3
NBCI Gene record:
Edar (13608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368849 TCCTGTGGATACGGCACTAAA pLKO_005 434 CDS 100% 13.200 18.480 N Edar n/a
2 TRCN0000362877 CAGTCACACACCATGGTATAA pLKO_005 2097 3UTR 100% 13.200 10.560 N Edar n/a
3 TRCN0000067841 CCAACTGTGGTGAGAACGAAT pLKO.1 345 CDS 100% 4.950 3.960 N Edar n/a
4 TRCN0000362876 AGTTCTCCAAAGGAGGTTATC pLKO_005 492 CDS 100% 10.800 7.560 N Edar n/a
5 TRCN0000378427 CAACTGTGGTGAGAACGAATA pLKO_005 346 CDS 100% 10.800 7.560 N Edar n/a
6 TRCN0000067842 CCCTGATTATTGCCATGTCTA pLKO.1 819 CDS 100% 4.950 3.465 N Edar n/a
7 TRCN0000059233 CCTCATCATCATGTTCTACAT pLKO.1 868 CDS 100% 4.950 3.465 N EDAR n/a
8 TRCN0000067840 GCTAACACACACGAGGAGAAA pLKO.1 956 CDS 100% 4.950 3.465 N Edar n/a
9 TRCN0000067839 CCTTGAGAAGACAAGCCGAAT pLKO.1 1315 CDS 100% 4.050 2.835 N Edar n/a
10 TRCN0000067838 GCTCACAAAGTTGGTGCAGAT pLKO.1 1492 CDS 100% 4.050 2.835 N Edar n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.