Transcript: Mouse NM_010158.2

Mus musculus KH domain containing, RNA binding, signal transduction associated 3 (Khdrbs3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Khdrbs3 (13992)
Length:
1954
CDS:
327..1367

Additional Resources:

NCBI RefSeq record:
NM_010158.2
NBCI Gene record:
Khdrbs3 (13992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102325 GCCGATTACAAGTGCAGACAA pLKO.1 1782 3UTR 100% 4.950 3.960 N Khdrbs3 n/a
2 TRCN0000352005 GCCGATTACAAGTGCAGACAA pLKO_005 1782 3UTR 100% 4.950 3.960 N Khdrbs3 n/a
3 TRCN0000417271 ATCTGAATGGATGGAACTTAA pLKO_005 1476 3UTR 100% 13.200 9.240 N KHDRBS3 n/a
4 TRCN0000102328 GCAGCTGATTACTACGATTAT pLKO.1 1218 CDS 100% 13.200 9.240 N Khdrbs3 n/a
5 TRCN0000352004 GCAGCTGATTACTACGATTAT pLKO_005 1218 CDS 100% 13.200 9.240 N Khdrbs3 n/a
6 TRCN0000348709 CCTATGGAGAGTATGACTATG pLKO_005 1120 CDS 100% 10.800 7.560 N Khdrbs3 n/a
7 TRCN0000102327 CGTGGTGATAAACAAGAACAT pLKO.1 467 CDS 100% 4.950 3.465 N Khdrbs3 n/a
8 TRCN0000352003 CGTGGTGATAAACAAGAACAT pLKO_005 467 CDS 100% 4.950 3.465 N Khdrbs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.