Transcript: Mouse NM_010176.4

Mus musculus fumarylacetoacetate hydrolase (Fah), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Mus musculus (mouse)
Gene:
Fah (14085)
Length:
1597
CDS:
220..1479

Additional Resources:

NCBI RefSeq record:
NM_010176.4
NBCI Gene record:
Fah (14085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010176.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443496 ACTTACCTGTGGGATACCATG pLKO_005 680 CDS 100% 4.050 5.670 N Fah n/a
2 TRCN0000101772 CCACTCTGTTAATGGATGCAA pLKO.1 1215 CDS 100% 3.000 4.200 N Fah n/a
3 TRCN0000101771 CGATGAGACAACTCTCAATAA pLKO.1 405 CDS 100% 1.320 1.848 N Fah n/a
4 TRCN0000101770 CCAGCCCTACACATTTGATAT pLKO.1 1089 CDS 100% 13.200 9.240 N Fah n/a
5 TRCN0000437320 GCCACCAATGTTGGCATTATG pLKO_005 619 CDS 100% 13.200 9.240 N Fah n/a
6 TRCN0000435160 ATGGTGCCTGCAGACTCTTAG pLKO_005 788 CDS 100% 10.800 7.560 N Fah n/a
7 TRCN0000435841 GCTACCATCTGCAGGTCTAAC pLKO_005 1153 CDS 100% 10.800 7.560 N Fah n/a
8 TRCN0000416049 AGCAACCCAAAGCCACGGATT pLKO_005 295 CDS 100% 4.050 2.835 N Fah n/a
9 TRCN0000101774 CCTCCATTGTGGTATCTGGAA pLKO.1 710 CDS 100% 2.640 1.848 N Fah n/a
10 TRCN0000101773 CCTGAGTGTCATTAAACACCT pLKO.1 345 CDS 100% 2.640 1.584 N Fah n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010176.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.