Transcript: Mouse NM_010220.4

Mus musculus FK506 binding protein 5 (Fkbp5), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Fkbp5 (14229)
Length:
3884
CDS:
220..1590

Additional Resources:

NCBI RefSeq record:
NM_010220.4
NBCI Gene record:
Fkbp5 (14229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010220.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111799 CGAGATGTGGTGTTCGTTGTT pLKO.1 769 CDS 100% 4.950 3.960 N Fkbp5 n/a
2 TRCN0000327410 CGAGATGTGGTGTTCGTTGTT pLKO_005 769 CDS 100% 4.950 3.960 N Fkbp5 n/a
3 TRCN0000111798 GAAGAAAGACAGAGGAGTATT pLKO.1 300 CDS 100% 13.200 9.240 N Fkbp5 n/a
4 TRCN0000327408 GAAGAAAGACAGAGGAGTATT pLKO_005 300 CDS 100% 13.200 9.240 N Fkbp5 n/a
5 TRCN0000111797 CCATCAAATGCAACTCTCTTT pLKO.1 586 CDS 100% 4.950 3.465 N Fkbp5 n/a
6 TRCN0000327336 CCATCAAATGCAACTCTCTTT pLKO_005 586 CDS 100% 4.950 3.465 N Fkbp5 n/a
7 TRCN0000111796 CGAGGGATACTCAAACCCAAA pLKO.1 687 CDS 100% 4.050 2.835 N Fkbp5 n/a
8 TRCN0000327334 CGAGGGATACTCAAACCCAAA pLKO_005 687 CDS 100% 4.050 2.835 N Fkbp5 n/a
9 TRCN0000111795 GCGGGTGATGAGATTTGCTTA pLKO.1 1999 3UTR 100% 4.950 2.970 N Fkbp5 n/a
10 TRCN0000327481 GCGGGTGATGAGATTTGCTTA pLKO_005 1999 3UTR 100% 4.950 2.970 N Fkbp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010220.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.