Transcript: Mouse NM_010244.3

Mus musculus Friend virus susceptibility 1 (Fv1), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Mus musculus (mouse)
Gene:
Fv1 (14349)
Length:
1380
CDS:
1..1380

Additional Resources:

NCBI RefSeq record:
NM_010244.3
NBCI Gene record:
Fv1 (14349)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249866 TCGAGCGGTAAGGAACTTAAT pLKO_005 163 CDS 100% 13.200 18.480 N Fv1 n/a
2 TRCN0000257955 ATGCACATAAATGATCTAAAG pLKO_005 319 CDS 100% 10.800 15.120 N Fv1 n/a
3 TRCN0000249867 GATAATGACTCTCCGGATAAT pLKO_005 73 CDS 100% 13.200 10.560 N Fv1 n/a
4 TRCN0000257959 GTGAGGGCACTGATTGGTAAA pLKO_005 490 CDS 100% 10.800 7.560 N Fv1 n/a
5 TRCN0000249868 TGACACCCTGGAGTGGTATTC pLKO_005 1035 CDS 100% 10.800 7.560 N Fv1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.