Transcript: Mouse NM_010264.4

Mus musculus nuclear receptor subfamily 6, group A, member 1 (Nr6a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nr6a1 (14536)
Length:
6185
CDS:
245..1732

Additional Resources:

NCBI RefSeq record:
NM_010264.4
NBCI Gene record:
Nr6a1 (14536)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026049 CCAAACCGCTTTCCTGATCTT pLKO.1 1589 CDS 100% 4.950 6.930 N Nr6a1 n/a
2 TRCN0000019743 CGAGCTCTCAATCAAGGATTA pLKO.1 1216 CDS 100% 10.800 8.640 N NR6A1 n/a
3 TRCN0000026018 CCAGATGATCGAGCTGAACAA pLKO.1 440 CDS 100% 4.950 3.960 N Nr6a1 n/a
4 TRCN0000026036 CCAGTAGGTCTGTGGAACTAA pLKO.1 882 CDS 100% 5.625 3.938 N Nr6a1 n/a
5 TRCN0000026020 GCCTCCACATTATCAATACAT pLKO.1 946 CDS 100% 5.625 3.938 N Nr6a1 n/a
6 TRCN0000025989 GCATTGGACCAGTCCAGATAT pLKO.1 714 CDS 100% 13.200 7.920 N Nr6a1 n/a
7 TRCN0000420827 AGTACTGCCGCCTGCTCAAAT pLKO_005 627 CDS 100% 13.200 9.240 N NR6A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.