Transcript: Mouse NM_010280.4

Mus musculus glial cell line derived neurotrophic factor family receptor alpha 3 (Gfra3), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gfra3 (14587)
Length:
1997
CDS:
168..1361

Additional Resources:

NCBI RefSeq record:
NM_010280.4
NBCI Gene record:
Gfra3 (14587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010280.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078865 CCACTGTCATCCTATGGACAT pLKO.1 968 CDS 100% 4.050 3.240 N Gfra3 n/a
2 TRCN0000078866 AGAAAGAAATGCGAGGCTAAT pLKO.1 300 CDS 100% 10.800 7.560 N Gfra3 n/a
3 TRCN0000078867 CAGAAAGAAATGCGAGGCTAA pLKO.1 299 CDS 100% 4.050 2.835 N Gfra3 n/a
4 TRCN0000060738 CCATTGCAGCTAAGATGCGTT pLKO.1 1189 CDS 100% 2.640 1.848 N GFRA3 n/a
5 TRCN0000078864 GCTACCTGTCTGGACATTTAT pLKO.1 489 CDS 100% 15.000 9.000 N Gfra3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010280.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.