Transcript: Mouse NM_010284.3

Mus musculus growth hormone receptor (Ghr), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Mus musculus (mouse)
Gene:
Ghr (14600)
Length:
4302
CDS:
363..2315

Additional Resources:

NCBI RefSeq record:
NM_010284.3
NBCI Gene record:
Ghr (14600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010284.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349024 ATGCCCAAGTAAGCGACATTA pLKO_005 1855 CDS 100% 13.200 18.480 N Ghr n/a
2 TRCN0000067228 CCCGACTTCTACAATGATGAT pLKO.1 1389 CDS 100% 4.950 6.930 N Ghr n/a
3 TRCN0000301487 CCCGACTTCTACAATGATGAT pLKO_005 1389 CDS 100% 4.950 6.930 N Ghr n/a
4 TRCN0000349000 CAGCGAAGTCCTCCGTGTAAT pLKO_005 1115 CDS 100% 13.200 9.240 N Ghr n/a
5 TRCN0000304282 GAAATTGAATGCAGATTATAG pLKO_005 2667 3UTR 100% 13.200 9.240 N Ghr n/a
6 TRCN0000067232 GCTTTAACCAAGAGGACATTT pLKO.1 2071 CDS 100% 13.200 9.240 N Ghr n/a
7 TRCN0000067229 CCCACATCACTGGCAAACATT pLKO.1 1827 CDS 100% 5.625 3.938 N Ghr n/a
8 TRCN0000067231 GCTGCAAGAATTGCTCATGAA pLKO.1 645 CDS 100% 4.950 3.465 N Ghr n/a
9 TRCN0000301486 GCTGCAAGAATTGCTCATGAA pLKO_005 645 CDS 100% 4.950 3.465 N Ghr n/a
10 TRCN0000067230 GCTTTGCCTTTGCCTGACAAA pLKO.1 2232 CDS 100% 4.950 3.465 N Ghr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010284.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.