Transcript: Mouse NM_010285.3

Mus musculus growth hormone releasing hormone (Ghrh), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ghrh (14601)
Length:
531
CDS:
105..416

Additional Resources:

NCBI RefSeq record:
NM_010285.3
NBCI Gene record:
Ghrh (14601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425064 AGGATGCAGCGACACGTAGAT pLKO_005 183 CDS 100% 4.950 6.930 N Ghrh n/a
2 TRCN0000440459 ACACGTAGATGCCATCTTCAC pLKO_005 194 CDS 100% 4.050 3.240 N Ghrh n/a
3 TRCN0000183933 CCATCTTCACCACCAACTACA pLKO.1 205 CDS 100% 4.950 3.465 N Ghrh n/a
4 TRCN0000180909 GAAAGTGATCCAGGACATCAT pLKO.1 254 CDS 100% 4.950 3.465 N Ghrh n/a
5 TRCN0000180215 CAGGACATCATGAACAAGCAA pLKO.1 264 CDS 100% 3.000 2.100 N Ghrh n/a
6 TRCN0000184097 CTTCACCACCAACTACAGGAA pLKO.1 209 CDS 100% 2.640 1.848 N Ghrh n/a
7 TRCN0000427129 GAGCATCTTGCAGGGATTCCC pLKO_005 368 CDS 100% 0.880 0.616 N Ghrh n/a
8 TRCN0000184614 GTGATCCAGGACATCATGAAC pLKO.1 258 CDS 100% 4.950 2.970 N Ghrh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.