Transcript: Mouse NM_010338.2

Mus musculus G protein-coupled receptor 37 (Gpr37), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gpr37 (14763)
Length:
3205
CDS:
885..2687

Additional Resources:

NCBI RefSeq record:
NM_010338.2
NBCI Gene record:
Gpr37 (14763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026130 CCGTGGAAACAAGCGGCAGAT pLKO.1 2276 CDS 100% 1.350 1.080 N Gpr37 n/a
2 TRCN0000026099 CCAGATGTACTATGAAATGAT pLKO.1 1943 CDS 100% 5.625 3.938 N Gpr37 n/a
3 TRCN0000026119 CGTGTGTCACAATTACTACAT pLKO.1 1700 CDS 100% 4.950 3.465 N Gpr37 n/a
4 TRCN0000026071 CCCAACTCTTCTTTCCGACAT pLKO.1 1300 CDS 100% 4.050 2.835 N Gpr37 n/a
5 TRCN0000026144 GCAAGGAAGATTTGGGCTTTA pLKO.1 2056 CDS 100% 10.800 6.480 N Gpr37 n/a
6 TRCN0000357220 TGCAAGATCGTGCCCTATATA pLKO_005 1845 CDS 100% 15.000 21.000 N GPR37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.