Transcript: Mouse NM_010340.2

Mus musculus G-protein-coupled receptor 50 (Gpr50), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gpr50 (14765)
Length:
3086
CDS:
126..1901

Additional Resources:

NCBI RefSeq record:
NM_010340.2
NBCI Gene record:
Gpr50 (14765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220815 CCTCTCATCATAGTTGGTTAT pLKO.1 747 CDS 100% 10.800 7.560 N Gpr50 n/a
2 TRCN0000220816 CCTGCCTCTGTCCATTTCAAA pLKO.1 1431 CDS 100% 5.625 3.938 N Gpr50 n/a
3 TRCN0000220814 CCCTACCCTTTGATGCTGTAT pLKO.1 390 CDS 100% 4.950 3.465 N Gpr50 n/a
4 TRCN0000220813 GCCAGCTCTAATCATCTTCAT pLKO.1 221 CDS 100% 4.950 3.465 N Gpr50 n/a
5 TRCN0000220812 GCTCCGAAATTCTGGCAACAT pLKO.1 323 CDS 100% 4.950 3.465 N Gpr50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.