Transcript: Mouse NM_010388.4

Mus musculus histocompatibility 2, class II, locus Mb2 (H2-DMb2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
H2-DMb2 (15000)
Length:
786
CDS:
1..786

Additional Resources:

NCBI RefSeq record:
NM_010388.4
NBCI Gene record:
H2-DMb2 (15000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067043 GCCTTATTCATCGCTTGCAAA pLKO.1 254 CDS 100% 4.950 6.930 N H2-DMb2 n/a
2 TRCN0000067044 CTGTCTAGATTGGCTGAAATA pLKO.1 205 CDS 100% 13.200 9.240 N H2-DMb2 n/a
3 TRCN0000414468 TAACACAAGGGAGCCCGTGAT pLKO_005 375 CDS 100% 4.050 2.430 N H2-DMb2 n/a
4 TRCN0000067045 TCAACGAACAGGAGAGCCTTA pLKO.1 239 CDS 100% 4.050 2.430 N H2-DMb2 n/a
5 TRCN0000436827 CAGATGGCGCAAGTCTCATTC pLKO_005 714 CDS 100% 10.800 5.400 Y H2-DMb2 n/a
6 TRCN0000434079 CCCAATGGAGACTGGACATAC pLKO_005 502 CDS 100% 10.800 5.400 Y H2-DMb2 n/a
7 TRCN0000419263 ATCTGTCCGAGTAGCCCAAAC pLKO_005 345 CDS 100% 6.000 3.000 Y H2-DMb2 n/a
8 TRCN0000067047 TGTGTTTCCTTCAACAAAGAT pLKO.1 127 CDS 100% 5.625 2.813 Y H2-DMb2 n/a
9 TRCN0000066715 AGTAGCCCAAACCACACCTTT pLKO.1 354 CDS 100% 4.950 2.475 Y H2-DMb1 n/a
10 TRCN0000066717 CATCTTCTGTGTTGGCTTCTT pLKO.1 693 CDS 100% 4.950 2.475 Y H2-DMb1 n/a
11 TRCN0000436213 GACCATCACATGGATGAAGAA pLKO_005 435 CDS 100% 4.950 2.475 Y H2-DMb2 n/a
12 TRCN0000067046 CAGTCTCCTACCTAGCCCTAA pLKO.1 527 CDS 100% 4.050 2.025 Y H2-DMb2 n/a
13 TRCN0000066714 CTTCACATACTGTGTTTCCTT pLKO.1 117 CDS 100% 3.000 1.500 Y H2-DMb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.