Transcript: Mouse NM_010398.3

Mus musculus histocompatibility 2, T region locus 23 (H2-T23), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
H2-T23 (15040)
Length:
1317
CDS:
33..1106

Additional Resources:

NCBI RefSeq record:
NM_010398.3
NBCI Gene record:
H2-T23 (15040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348864 AGATACCTACGGCTGGGAAAT pLKO_005 600 CDS 100% 10.800 14.040 N H2-T23 n/a
2 TRCN0000067547 CACCCTAGATCTGAAGATGAA pLKO.1 666 CDS 100% 4.950 6.435 N H2-T23 n/a
3 TRCN0000067543 GAGGAGACACATAGGTGTAAA pLKO.1 1019 CDS 100% 13.200 9.240 N H2-T23 n/a
4 TRCN0000375906 ACATAGCCTCACAGATCTCTA pLKO_005 502 CDS 100% 4.950 3.465 N H2-T23 n/a
5 TRCN0000375975 TCCTGGACCGCGAATGACATA pLKO_005 486 CDS 100% 4.950 3.465 N H2-T23 n/a
6 TRCN0000348865 AGATCTCTAAGCACAAGTCAG pLKO_005 514 CDS 100% 4.050 2.835 N H2-T23 n/a
7 TRCN0000067544 CGGCTACTACAATCAGAGTAA pLKO.1 338 CDS 100% 4.950 2.475 Y H2-T23 n/a
8 TRCN0000067545 CCAGGATTACATCTCCCTGAA pLKO.1 452 CDS 100% 4.050 2.025 Y H2-T23 n/a
9 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 1171 3UTR 100% 2.640 1.320 Y P3h3 n/a
10 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 1171 3UTR 100% 2.640 1.320 Y P3h3 n/a
11 TRCN0000067546 GCTATGCTCATGTTCTAGGCA pLKO.1 1045 CDS 100% 0.750 0.375 Y H2-T23 n/a
12 TRCN0000066803 GTATTACACATGCCATGTGTA pLKO.1 857 CDS 100% 0.495 0.248 Y H2-K1 n/a
13 TRCN0000067006 GTCTCCAACATGGTAATCATT pLKO.1 933 CDS 100% 5.625 2.813 Y H2-Q2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.