Transcript: Mouse NM_010414.3

Mus musculus huntingtin (Htt), mRNA.

Source:
NCBI, updated 2017-06-22
Taxon:
Mus musculus (mouse)
Gene:
Htt (15194)
Length:
13237
CDS:
168..9530

Additional Resources:

NCBI RefSeq record:
NM_010414.3
NBCI Gene record:
Htt (15194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305858 GTGAATCATTGTCTAACAATA pLKO_005 405 CDS 100% 13.200 18.480 N Htt n/a
2 TRCN0000311423 GCTAGGTTGACCAGGTGTTTG pLKO_005 9765 3UTR 100% 10.800 15.120 N Htt n/a
3 TRCN0000100347 CCACTGTAGTTTACAAGGTTT pLKO.1 9139 CDS 100% 4.950 6.930 N Htt n/a
4 TRCN0000100348 CCTCATCCATTGTGTGCGATT pLKO.1 7025 CDS 100% 4.050 5.670 N Htt n/a
5 TRCN0000305859 AGGGAATCAGAGGCAATTATT pLKO_005 4572 CDS 100% 15.000 12.000 N Htt n/a
6 TRCN0000019869 CCGTGCAGATAAGAATGCTAT pLKO.1 4343 CDS 100% 4.950 3.960 N HTT n/a
7 TRCN0000323038 CCGTGCAGATAAGAATGCTAT pLKO_005 4343 CDS 100% 4.950 3.960 N HTT n/a
8 TRCN0000100349 CCTCCAGTACAAGACTTTATT pLKO.1 5907 CDS 100% 15.000 10.500 N Htt n/a
9 TRCN0000325010 CCTCCAGTACAAGACTTTATT pLKO_005 5907 CDS 100% 15.000 10.500 N Htt n/a
10 TRCN0000305791 ATAGCTTACTGCCAAGTATAA pLKO_005 3070 CDS 100% 13.200 9.240 N Htt n/a
11 TRCN0000100346 GCCAACTATAAGGTCACCTTA pLKO.1 3852 CDS 100% 4.950 2.970 N Htt n/a
12 TRCN0000100345 GCAGGGAACATGCACTATGTT pLKO.1 9694 3UTR 100% 0.563 0.338 N Htt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.