Transcript: Mouse NM_010487.2

Mus musculus ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (Elavl3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Elavl3 (15571)
Length:
5027
CDS:
426..1529

Additional Resources:

NCBI RefSeq record:
NM_010487.2
NBCI Gene record:
Elavl3 (15571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010487.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112048 GCCGAATCATCACTTCCAGAA pLKO.1 871 CDS 100% 4.050 5.670 N Elavl3 n/a
2 TRCN0000112046 CCGAGATTTCACCACCAACAA pLKO.1 1373 CDS 100% 4.950 3.465 N Elavl3 n/a
3 TRCN0000112045 CCTGGCCTATACTGAGAGAAA pLKO.1 1945 3UTR 100% 4.950 3.465 N Elavl3 n/a
4 TRCN0000112047 CGGCTGGACAATTTGCTCAAT pLKO.1 1137 CDS 100% 4.950 3.465 N Elavl3 n/a
5 TRCN0000112049 GCTGGACAATTTGCTCAATAT pLKO.1 1139 CDS 100% 13.200 7.920 N Elavl3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2354 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000112096 CCAACCTCATCGTCAACTATT pLKO.1 541 CDS 100% 13.200 6.600 Y Elavl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010487.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.