Transcript: Mouse NM_010511.3

Mus musculus interferon gamma receptor 1 (Ifngr1), mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Ifngr1 (15979)
Length:
2126
CDS:
138..1571

Additional Resources:

NCBI RefSeq record:
NM_010511.3
NBCI Gene record:
Ifngr1 (15979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010511.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305499 AGCTCTCCGTCCTCGTATTTC pLKO_005 577 CDS 100% 13.200 18.480 N Ifngr1 n/a
2 TRCN0000067372 CCTGTTACACATTCGACTATA pLKO.1 655 CDS 100% 13.200 18.480 N Ifngr1 n/a
3 TRCN0000309878 CCTGTTACACATTCGACTATA pLKO_005 655 CDS 100% 13.200 18.480 N Ifngr1 n/a
4 TRCN0000067370 CGGTTATGACAAACCGCACAT pLKO.1 1466 CDS 100% 0.405 0.567 N Ifngr1 n/a
5 TRCN0000067368 CCACATAGAATATCAGACTTA pLKO.1 1668 3UTR 100% 4.950 3.960 N Ifngr1 n/a
6 TRCN0000351402 CCACATAGAATATCAGACTTA pLKO_005 1668 3UTR 100% 4.950 3.960 N Ifngr1 n/a
7 TRCN0000305500 TTGCTCCTCTTACCGTCTTTA pLKO_005 916 CDS 100% 13.200 9.240 N Ifngr1 n/a
8 TRCN0000067369 GCCAGAGTTAAAGCTAAGGTT pLKO.1 453 CDS 100% 3.000 2.100 N Ifngr1 n/a
9 TRCN0000335486 GCCAGAGTTAAAGCTAAGGTT pLKO_005 453 CDS 100% 3.000 2.100 N Ifngr1 n/a
10 TRCN0000067371 CCACACTGGATTCCAGATATT pLKO.1 781 CDS 100% 13.200 7.920 N Ifngr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010511.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.