Transcript: Mouse NM_010565.4

Mus musculus inhibin beta-C (Inhbc), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Inhbc (16325)
Length:
1976
CDS:
153..1211

Additional Resources:

NCBI RefSeq record:
NM_010565.4
NBCI Gene record:
Inhbc (16325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010565.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067830 GCCACCCAGACCATGAATATA pLKO.1 582 CDS 100% 15.000 10.500 N Inhbc n/a
2 TRCN0000067829 CCTCTGTCTTTGCTCTACTAT pLKO.1 1122 CDS 100% 5.625 3.938 N Inhbc n/a
3 TRCN0000067828 CCTCACCTTGACAAGTCAGTA pLKO.1 635 CDS 100% 4.950 3.465 N Inhbc n/a
4 TRCN0000067832 GCTTCTCGATTTGGCCAAGAA pLKO.1 278 CDS 100% 4.950 3.465 N Inhbc n/a
5 TRCN0000067831 GCAACATTGTCAAGACGGATA pLKO.1 1153 CDS 100% 4.050 2.835 N Inhbc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010565.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.