Transcript: Mouse NM_010584.3

Mus musculus intelectin 1 (galactofuranose binding) (Itln1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Itln1 (16429)
Length:
1149
CDS:
81..1022

Additional Resources:

NCBI RefSeq record:
NM_010584.3
NBCI Gene record:
Itln1 (16429)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173838 CTCGGAAGACAGCCTCTTATT pLKO.1 727 CDS 100% 13.200 7.920 N Itln1 n/a
2 TRCN0000176290 CACGAAGAATGGTGTCATCTA pLKO.1 257 CDS 100% 4.950 2.970 N Itln1 n/a
3 TRCN0000162646 CCAACTACAACACCTTTGGAT pLKO.1 433 CDS 100% 3.000 1.500 Y ITLN1 n/a
4 TRCN0000147469 CTATGACTTTGGTGATGCTAA pLKO.1 710 CDS 100% 4.950 2.475 Y ITLN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.