Transcript: Mouse NM_010620.1

Mus musculus kinesin family member 15 (Kif15), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Kif15 (209737)
Length:
4840
CDS:
54..4217

Additional Resources:

NCBI RefSeq record:
NM_010620.1
NBCI Gene record:
Kif15 (209737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412917 CAAAGAGCCAAGCTGATTAAA pLKO_005 1125 CDS 100% 15.000 10.500 N KIF15 n/a
2 TRCN0000091714 CGCAACAACAAATTGTCATTA pLKO.1 2787 CDS 100% 13.200 9.240 N Kif15 n/a
3 TRCN0000091713 CCCAGCTATCTTCATACACAT pLKO.1 4222 3UTR 100% 4.950 3.465 N Kif15 n/a
4 TRCN0000091715 GCACATAAAGAAGGGAGTCTT pLKO.1 620 CDS 100% 4.950 3.465 N Kif15 n/a
5 TRCN0000091716 GCTCAGACTAAGAATGAGTTT pLKO.1 2418 CDS 100% 4.950 3.465 N Kif15 n/a
6 TRCN0000091717 CACATAAAGAAGGGAGTCTTT pLKO.1 621 CDS 100% 0.495 0.297 N Kif15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.