Transcript: Mouse NM_010635.3

Mus musculus Kruppel-like factor 1 (erythroid) (Klf1), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Mus musculus (mouse)
Gene:
Klf1 (16596)
Length:
1476
CDS:
48..1124

Additional Resources:

NCBI RefSeq record:
NM_010635.3
NBCI Gene record:
Klf1 (16596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071546 CCACTTAGCTCTGCACATGAA pLKO.1 1091 CDS 100% 4.950 3.465 N Klf1 n/a
2 TRCN0000071545 TGAGACTGTCTTACCCTCCAT pLKO.1 59 CDS 100% 2.640 1.848 N Klf1 n/a
3 TRCN0000071543 CCGGCGAACTTTGGCACCTAA pLKO.1 836 CDS 100% 1.650 1.155 N Klf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.