Transcript: Mouse NM_010645.3

Mus musculus kallikrein 1-related peptidase b1 (Klk1b1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Klk1b1 (16623)
Length:
867
CDS:
37..822

Additional Resources:

NCBI RefSeq record:
NM_010645.3
NBCI Gene record:
Klk1b1 (16623)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031308 GAACAACGTTTGGCTGGGCAA pLKO.1 246 CDS 100% 2.160 3.024 N Klk1b1 n/a
2 TRCN0000031305 GACTGTGACAAAGCCTATGTA pLKO.1 583 CDS 100% 5.625 3.938 N Klk1b1 n/a
3 TRCN0000031304 GCAGCATTATACCTGTCAAGT pLKO.1 509 CDS 100% 4.950 3.465 N Klk1b1 n/a
4 TRCN0000438562 GGCTATAACCCATGTGGTGAA pLKO_005 724 CDS 100% 4.050 2.835 N Klk1b1 n/a
5 TRCN0000417104 GAGTGAAGGGTGGAGGCAAAG pLKO_005 635 CDS 100% 2.000 1.400 N Klk1b1 n/a
6 TRCN0000031307 CTCGAATAGTTGGAGGATTTA pLKO.1 104 CDS 100% 13.200 6.600 Y Klk1b1 n/a
7 TRCN0000031306 CCTGCTGACATCACAGATGTT pLKO.1 421 CDS 100% 4.950 2.475 Y Klk1b1 n/a
8 TRCN0000031747 CCACTGATCTGTGATGGTGTT pLKO.1 682 CDS 100% 4.050 2.025 Y Klk1b5 n/a
9 TRCN0000032026 CCCACTGATCTGTGATGGTAT pLKO.1 681 CDS 100% 4.950 2.475 Y Klk1b4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.