Transcript: Mouse NM_010683.2

Mus musculus laminin, gamma 1 (Lamc1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lamc1 (226519)
Length:
7622
CDS:
248..5071

Additional Resources:

NCBI RefSeq record:
NM_010683.2
NBCI Gene record:
Lamc1 (226519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055420 GCAGAGATCATTAAGGATATT pLKO.1 4979 CDS 100% 13.200 10.560 N Lamc1 n/a
2 TRCN0000301810 GCAGAGATCATTAAGGATATT pLKO_005 4979 CDS 100% 13.200 10.560 N Lamc1 n/a
3 TRCN0000055418 CCCATCTAGTTCCTGCACTTT pLKO.1 6203 3UTR 100% 4.950 3.960 N Lamc1 n/a
4 TRCN0000055419 CCCTGGAGAATGAAGCAAATA pLKO.1 4083 CDS 100% 13.200 9.240 N Lamc1 n/a
5 TRCN0000301865 CCCTGGAGAATGAAGCAAATA pLKO_005 4083 CDS 100% 13.200 9.240 N Lamc1 n/a
6 TRCN0000055422 CCTGAACAACTTGACCTCTAT pLKO.1 2182 CDS 100% 4.950 3.465 N Lamc1 n/a
7 TRCN0000301807 CCTGAACAACTTGACCTCTAT pLKO_005 2182 CDS 100% 4.950 3.465 N Lamc1 n/a
8 TRCN0000055421 CGAGTGAAACTCCAGGAGTTA pLKO.1 3377 CDS 100% 4.950 3.465 N Lamc1 n/a
9 TRCN0000301808 CGAGTGAAACTCCAGGAGTTA pLKO_005 3377 CDS 100% 4.950 3.465 N Lamc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.