Transcript: Mouse NM_010700.3

Mus musculus low density lipoprotein receptor (Ldlr), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Ldlr (16835)
Length:
4549
CDS:
203..2791

Additional Resources:

NCBI RefSeq record:
NM_010700.3
NBCI Gene record:
Ldlr (16835)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173777 CGGAGGTGACCAACAATAGAA pLKO.1 1506 CDS 100% 5.625 4.500 N Ldlr n/a
2 TRCN0000284546 AGTCGCCATTCTCCCTTAATA pLKO_005 3425 3UTR 100% 15.000 10.500 N Ldlr n/a
3 TRCN0000271881 ACGGGTTCAGATGTGAATTTG pLKO_005 2105 CDS 100% 13.200 9.240 N Ldlr n/a
4 TRCN0000271926 CACCTGTCAGTCCAATCAATT pLKO_005 400 CDS 100% 13.200 9.240 N Ldlr n/a
5 TRCN0000271877 TGCAAGACCAACGAGTGTTTG pLKO_005 1142 CDS 100% 10.800 7.560 N Ldlr n/a
6 TRCN0000174795 GATGTCATAAACGAAGCCATT pLKO.1 2066 CDS 100% 4.050 2.835 N Ldlr n/a
7 TRCN0000284544 TCCGCTGCAACTCATCCATAT pLKO_005 660 CDS 100% 10.800 6.480 N Ldlr n/a
8 TRCN0000176045 GCAACATCTACTGGACAGATT pLKO.1 1659 CDS 100% 4.950 2.970 N Ldlr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.