Transcript: Mouse NM_010719.5

Mus musculus lipase, hormone sensitive (Lipe), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Lipe (16890)
Length:
3221
CDS:
379..2787

Additional Resources:

NCBI RefSeq record:
NM_010719.5
NBCI Gene record:
Lipe (16890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010719.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445309 GTTCAACTGGAGAGCGGATAT pLKO_005 1739 CDS 100% 10.800 15.120 N Lipe n/a
2 TRCN0000431366 TCCGTGCTATGGCCTACTATG pLKO_005 869 CDS 100% 10.800 15.120 N Lipe n/a
3 TRCN0000032377 GCTAGATGACTCGGTCATGTT pLKO.1 2595 CDS 100% 4.950 3.960 N Lipe n/a
4 TRCN0000032376 CCTACTACACAAATCCCGCTA pLKO.1 762 CDS 100% 2.160 1.728 N Lipe n/a
5 TRCN0000032374 CCCTATCTTCTCCATCGACTA pLKO.1 1629 CDS 100% 4.050 2.835 N Lipe n/a
6 TRCN0000032375 CGCATCATACAGAACCTGGAT pLKO.1 1189 CDS 100% 2.640 1.848 N Lipe n/a
7 TRCN0000032378 CGCAGAAGACAATATGGCCTT pLKO.1 546 CDS 100% 2.160 1.512 N Lipe n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010719.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.