Transcript: Mouse NM_010724.2

Mus musculus proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Psmb8 (16913)
Length:
1223
CDS:
205..1035

Additional Resources:

NCBI RefSeq record:
NM_010724.2
NBCI Gene record:
Psmb8 (16913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031876 GAACAAAGTGATCGAGATTAA pLKO.1 513 CDS 100% 13.200 18.480 N Psmb8 n/a
2 TRCN0000031874 CCAGGACTTTACTACGTAGAT pLKO.1 745 CDS 100% 4.950 6.930 N Psmb8 n/a
3 TRCN0000031875 AGGTTGTATTATCTTCGGAAT pLKO.1 610 CDS 100% 4.050 5.670 N Psmb8 n/a
4 TRCN0000447289 GAAAGTGGAGAGTTCCGATGT pLKO_005 975 CDS 100% 4.050 5.670 N Psmb8 n/a
5 TRCN0000430767 GGCCGCAGAGCTATTGCTTAT pLKO_005 886 CDS 100% 10.800 7.560 N Psmb8 n/a
6 TRCN0000434974 ACAACCACACTCGCCTTCAAG pLKO_005 421 CDS 100% 4.950 3.465 N Psmb8 n/a
7 TRCN0000416237 ACCGCATTCCTGAGGTCCTTT pLKO_005 355 CDS 100% 4.950 3.465 N Psmb8 n/a
8 TRCN0000031877 GACCAGGAAAGGAATGTTCAA pLKO.1 382 CDS 100% 4.950 3.465 N Psmb8 n/a
9 TRCN0000423371 AGCGGGAACACCTATGCCTAT pLKO_005 808 CDS 100% 4.050 2.835 N Psmb8 n/a
10 TRCN0000031878 AGGGAGTTACATTAGCTCCTT pLKO.1 486 CDS 100% 2.640 1.848 N Psmb8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.