Transcript: Mouse NM_010726.2

Mus musculus phytanoyl-CoA hydroxylase (Phyh), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Phyh (16922)
Length:
1474
CDS:
75..1091

Additional Resources:

NCBI RefSeq record:
NM_010726.2
NBCI Gene record:
Phyh (16922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183409 CCTGAACAATTCCAGTATACT pLKO.1 195 CDS 100% 5.625 7.875 N Phyh n/a
2 TRCN0000314260 CCTGAACAATTCCAGTATACT pLKO_005 195 CDS 100% 5.625 7.875 N Phyh n/a
3 TRCN0000183360 GCTCTTCCTTATAATTCCTTT pLKO.1 1224 3UTR 100% 4.950 3.465 N Phyh n/a
4 TRCN0000314262 GCTCTTCCTTATAATTCCTTT pLKO_005 1224 3UTR 100% 4.950 3.465 N Phyh n/a
5 TRCN0000183514 GCAACCTAATTGTTTGTGCTT pLKO.1 631 CDS 100% 2.640 1.848 N Phyh n/a
6 TRCN0000314261 GCAACCTAATTGTTTGTGCTT pLKO_005 631 CDS 100% 2.640 1.848 N Phyh n/a
7 TRCN0000183203 GAGGACATCAAAGCAAAGAAA pLKO.1 1248 3UTR 100% 5.625 3.375 N Phyh n/a
8 TRCN0000314263 GAGGACATCAAAGCAAAGAAA pLKO_005 1248 3UTR 100% 5.625 3.375 N Phyh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.