Transcript: Mouse NM_010771.6

Mus musculus matrin 3 (Matr3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Matr3 (17184)
Length:
4472
CDS:
317..2857

Additional Resources:

NCBI RefSeq record:
NM_010771.6
NBCI Gene record:
Matr3 (17184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010771.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074906 GAGACCGATCTTGCTAATTTA pLKO.1 2345 CDS 100% 15.000 21.000 N MATR3 n/a
2 TRCN0000074907 CCCATAATTTGCAGTCTATAT pLKO.1 555 CDS 100% 13.200 18.480 N MATR3 n/a
3 TRCN0000102415 CCGTTCTCTTTGACCAGTATT pLKO.1 3519 3UTR 100% 13.200 18.480 N Matr3 n/a
4 TRCN0000308814 CCGTTCTCTTTGACCAGTATT pLKO_005 3519 3UTR 100% 13.200 18.480 N Matr3 n/a
5 TRCN0000293618 GACCTCGCATAACTATCATAA pLKO_005 1030 CDS 100% 13.200 18.480 N MATR3 n/a
6 TRCN0000102417 CCTTCCTCATTATCAGAAATT pLKO.1 2782 CDS 100% 13.200 9.240 N Matr3 n/a
7 TRCN0000102419 GCCTTCCTCATTATCAGAAAT pLKO.1 2781 CDS 100% 13.200 9.240 N Matr3 n/a
8 TRCN0000308815 GCCTTCCTCATTATCAGAAAT pLKO_005 2781 CDS 100% 13.200 9.240 N Matr3 n/a
9 TRCN0000074905 GCACTTTAGAAGAGATAGTTT pLKO.1 862 CDS 100% 5.625 3.938 N MATR3 n/a
10 TRCN0000286101 GCACTTTAGAAGAGATAGTTT pLKO_005 862 CDS 100% 5.625 3.938 N MATR3 n/a
11 TRCN0000102418 CGGATTCCTAACAGAGGCATT pLKO.1 2048 CDS 100% 4.050 2.835 N Matr3 n/a
12 TRCN0000308822 CGGATTCCTAACAGAGGCATT pLKO_005 2048 CDS 100% 4.050 2.835 N Matr3 n/a
13 TRCN0000102416 CCCAAATTCTTCTACAGCTTA pLKO.1 732 CDS 100% 4.950 2.970 N Matr3 n/a
14 TRCN0000308813 CCCAAATTCTTCTACAGCTTA pLKO_005 732 CDS 100% 4.950 2.970 N Matr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010771.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.