Transcript: Mouse NM_010780.3

Mus musculus chymase 1, mast cell (Cma1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cma1 (17228)
Length:
1090
CDS:
105..887

Additional Resources:

NCBI RefSeq record:
NM_010780.3
NBCI Gene record:
Cma1 (17228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221467 CTCTGCCAACTTCAACTTTAT pLKO.1 536 CDS 100% 13.200 9.240 N Cma1 n/a
2 TRCN0000221468 GCAGTGGCTTCCTGATAAGAA pLKO.1 295 CDS 100% 5.625 3.938 N Cma1 n/a
3 TRCN0000221465 GCATCCTATGTACATCGGAAT pLKO.1 792 CDS 100% 4.050 2.430 N Cma1 n/a
4 TRCN0000221469 GCAGGAAGTAAAGATGAGACT pLKO.1 629 CDS 100% 2.640 1.584 N Cma1 n/a
5 TRCN0000221466 GCCCTGGATCAATAAGATCTT pLKO.1 854 CDS 100% 4.950 2.475 Y Cma1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.