Transcript: Mouse NM_010782.3

Mus musculus mast cell protease 9 (Mcpt9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mcpt9 (17232)
Length:
2000
CDS:
1228..1968

Additional Resources:

NCBI RefSeq record:
NM_010782.3
NBCI Gene record:
Mcpt9 (17232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032474 GTAAGAAAGGTTATGTGGCAA pLKO.1 1352 CDS 100% 2.640 1.848 N Mcpt9 n/a
2 TRCN0000032476 GCTGGAGCTGAGGAGATTATT pLKO.1 1273 CDS 100% 15.000 7.500 Y Mcpt9 n/a
3 TRCN0000031432 GAATGCACACAGCAGAAGATA pLKO.1 1477 CDS 100% 5.625 2.813 Y Cma2 n/a
4 TRCN0000031430 CCAAGTTCAATGACATCGTAT pLKO.1 1541 CDS 100% 4.950 2.475 Y Cma2 n/a
5 TRCN0000031429 CCCTGGATTAACAGAGTCATA pLKO.1 1936 CDS 100% 4.950 2.475 Y Cma2 n/a
6 TRCN0000032475 CCTATGTGAATACCTTCAGTA pLKO.1 1334 CDS 100% 4.950 2.475 Y Mcpt9 n/a
7 TRCN0000032478 CTGAGAGAGGTAGAACTGAAA pLKO.1 1708 CDS 100% 4.950 2.475 Y Mcpt9 n/a
8 TRCN0000087740 TCCACAAAGGTGGCATCAGTA pLKO.1 1798 CDS 100% 4.950 2.475 Y Mcptl n/a
9 TRCN0000031431 CCCTGCAATCTTCACCCGAAT pLKO.1 1902 CDS 100% 4.050 2.025 Y Cma2 n/a
10 TRCN0000032477 GAGGAGATTATTGGTGGTGTT pLKO.1 1282 CDS 100% 4.050 2.025 Y Mcpt9 n/a
11 TRCN0000087742 TGTATCTTCTGGACGCGGAAA pLKO.1 1872 CDS 100% 4.050 2.025 Y Mcptl n/a
12 TRCN0000031433 CCTCCAAATTACAATGTGTCT pLKO.1 1519 CDS 100% 2.640 1.320 Y Cma2 n/a
13 TRCN0000087741 CCTATGTGAATACCTTCAGAA pLKO.1 1334 CDS 100% 4.950 2.475 Y Mcptl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.