Transcript: Mouse NM_010808.4

Mus musculus matrix metallopeptidase 24 (Mmp24), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mmp24 (17391)
Length:
4306
CDS:
132..1988

Additional Resources:

NCBI RefSeq record:
NM_010808.4
NBCI Gene record:
Mmp24 (17391)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010808.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221964 CCTACAGCATTCACAATTATA pLKO.1 556 CDS 100% 15.000 21.000 N Mmp24 n/a
2 TRCN0000221963 GCTCTACACTATCTTCCAATT pLKO.1 1904 CDS 100% 10.800 15.120 N Mmp24 n/a
3 TRCN0000221967 GCCCGCATAGACGCAGCCTAT pLKO.1 1329 CDS 100% 0.000 0.000 N Mmp24 n/a
4 TRCN0000221966 GTGCCATACCATGAGATCAAA pLKO.1 666 CDS 100% 5.625 3.938 N Mmp24 n/a
5 TRCN0000221965 GAGGAGGAGAAATAAGCGATA pLKO.1 497 CDS 100% 4.050 2.835 N Mmp24 n/a
6 TRCN0000437964 AGCTGAAGTGGTGGGTGCATT pLKO_005 2112 3UTR 100% 4.950 3.465 N MMP24 n/a
7 TRCN0000052246 AGGAAGGATATTACACCTATT pLKO.1 1642 CDS 100% 10.800 6.480 N MMP24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010808.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.