Transcript: Mouse NM_010831.3

Mus musculus salt inducible kinase 1 (Sik1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Sik1 (17691)
Length:
4523
CDS:
149..2488

Additional Resources:

NCBI RefSeq record:
NM_010831.3
NBCI Gene record:
Sik1 (17691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221192 GCCGCCATTTACTACCTCCTA pLKO.1 1151 CDS 100% 2.640 3.696 N Sik1 n/a
2 TRCN0000274578 GGATATCAAGCTAGCAGATTT pLKO_005 631 CDS 100% 13.200 10.560 N Sik1 n/a
3 TRCN0000221191 ACACGGTTAGATTCTAGCAAT pLKO.1 329 CDS 100% 4.950 3.960 N Sik1 n/a
4 TRCN0000221190 GCTCACTTCAGCCCTTATTAT pLKO.1 1389 CDS 100% 15.000 10.500 N Sik1 n/a
5 TRCN0000274522 GCTCACTTCAGCCCTTATTAT pLKO_005 1389 CDS 100% 15.000 10.500 N Sik1 n/a
6 TRCN0000274615 CCCAAATATCATCAAGCTTTA pLKO_005 397 CDS 100% 10.800 7.560 N Sik1 n/a
7 TRCN0000322017 TGTAGTGGTTGGCGTTGTTTC pLKO_005 2882 3UTR 100% 10.800 7.560 N Sik1 n/a
8 TRCN0000221194 CTGGGACTGAACAAGATCAAA pLKO.1 1952 CDS 100% 5.625 3.938 N Sik1 n/a
9 TRCN0000001724 GAACCACCCAAATATCATCAA pLKO.1 391 CDS 100% 4.950 3.465 N NEK6 n/a
10 TRCN0000221193 GCTCTACATTGTCACAGAATT pLKO.1 442 CDS 100% 0.000 0.000 N Sik1 n/a
11 TRCN0000274520 GCTCTACATTGTCACAGAATT pLKO_005 442 CDS 100% 0.000 0.000 N Sik1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.