Transcript: Mouse NM_010836.3

Mus musculus msh homeobox 3 (Msx3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Msx3 (17703)
Length:
2287
CDS:
90..704

Additional Resources:

NCBI RefSeq record:
NM_010836.3
NBCI Gene record:
Msx3 (17703)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416567 GATAATCGGACGGTTAGAAAT pLKO_005 1126 3UTR 100% 13.200 18.480 N Msx3 n/a
2 TRCN0000417519 TTGATGACTGGAGCCTATTTA pLKO_005 843 3UTR 100% 15.000 12.000 N Msx3 n/a
3 TRCN0000070640 TGGCATGTACTACTTGTCTTA pLKO.1 683 CDS 100% 4.950 3.465 N Msx3 n/a
4 TRCN0000418198 TTGAGCCTCACTGAGACTCAG pLKO_005 459 CDS 100% 4.050 2.835 N Msx3 n/a
5 TRCN0000070639 CCAGAAGCAATACTTATCCAT pLKO.1 410 CDS 100% 3.000 2.100 N Msx3 n/a
6 TRCN0000070638 CGCAAGTTTCACCAGAAGCAA pLKO.1 399 CDS 100% 3.000 2.100 N Msx3 n/a
7 TRCN0000070641 GCAATACTTATCCATTGCGGA pLKO.1 416 CDS 100% 0.066 0.046 N Msx3 n/a
8 TRCN0000070642 CCGAGCCAAAGCCAAGCGGCT pLKO.1 503 CDS 100% 0.000 0.000 N Msx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.