Transcript: Mouse NM_010864.2

Mus musculus myosin VA (Myo5a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Myo5a (17918)
Length:
11684
CDS:
428..5989

Additional Resources:

NCBI RefSeq record:
NM_010864.2
NBCI Gene record:
Myo5a (17918)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100878 CGCTACAAGAAGCTCCATATT pLKO.1 3176 CDS 100% 13.200 18.480 N Myo5a n/a
2 TRCN0000100877 CGCACTATACAGATGCGGTTA pLKO.1 5825 CDS 100% 4.050 5.670 N Myo5a n/a
3 TRCN0000100879 CCTAAGAAGTATCAATCCTAT pLKO.1 4613 CDS 100% 4.950 3.465 N Myo5a n/a
4 TRCN0000100876 CGGTGGACTTACCAAGAGTTT pLKO.1 2525 CDS 100% 4.950 3.465 N Myo5a n/a
5 TRCN0000100875 GCGATGTGAAAGCTGCTGTTT pLKO.1 6522 3UTR 100% 4.950 3.465 N Myo5a n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9317 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.