Transcript: Mouse NM_010902.4

Mus musculus nuclear factor, erythroid derived 2, like 2 (Nfe2l2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nfe2l2 (18024)
Length:
2497
CDS:
256..2049

Additional Resources:

NCBI RefSeq record:
NM_010902.4
NBCI Gene record:
Nfe2l2 (18024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054658 CCAAAGCTAGTATAGCAATAA pLKO.1 2161 3UTR 100% 13.200 18.480 N Nfe2l2 n/a
2 TRCN0000301258 CCAAAGCTAGTATAGCAATAA pLKO_005 2161 3UTR 100% 13.200 18.480 N Nfe2l2 n/a
3 TRCN0000012129 CCCGAATTACAGTGTCTTAAT pLKO.1 814 CDS 100% 13.200 18.480 N Nfe2l2 n/a
4 TRCN0000304248 CCCGAATTACAGTGTCTTAAT pLKO_005 814 CDS 100% 13.200 18.480 N Nfe2l2 n/a
5 TRCN0000012130 GCTCGCATTGATCCGAGATAT pLKO.1 1713 CDS 100% 13.200 18.480 N Nfe2l2 n/a
6 TRCN0000304249 GCTCGCATTGATCCGAGATAT pLKO_005 1713 CDS 100% 13.200 18.480 N Nfe2l2 n/a
7 TRCN0000054662 GCCTTACTCTCCCAGTGAATA pLKO.1 1953 CDS 100% 13.200 9.240 N Nfe2l2 n/a
8 TRCN0000301179 GCCTTACTCTCCCAGTGAATA pLKO_005 1953 CDS 100% 13.200 9.240 N Nfe2l2 n/a
9 TRCN0000012132 CCAGCAGGACATGGATTTGAT pLKO.1 294 CDS 100% 5.625 3.938 N Nfe2l2 n/a
10 TRCN0000054659 CTTGAAGTCTTCAGCATGTTA pLKO.1 1915 CDS 100% 5.625 3.938 N Nfe2l2 n/a
11 TRCN0000301260 CTTGAAGTCTTCAGCATGTTA pLKO_005 1915 CDS 100% 5.625 3.938 N Nfe2l2 n/a
12 TRCN0000012131 CCACGCTGAAAGTTCAGTCTT pLKO.1 681 CDS 100% 4.950 3.465 N Nfe2l2 n/a
13 TRCN0000012128 GCAGAATTATAGCCAAAGCTA pLKO.1 2149 3UTR 100% 3.000 2.100 N Nfe2l2 n/a
14 TRCN0000054661 GAAGGCACAATGGAATTCAAT pLKO.1 1228 CDS 100% 0.000 0.000 N Nfe2l2 n/a
15 TRCN0000054660 GCGACAGAAGGACTATGAGTT pLKO.1 378 CDS 100% 4.950 3.465 N Nfe2l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.