Transcript: Mouse NM_010909.4

Mus musculus nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor like 1 (Nfkbil1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nfkbil1 (18038)
Length:
1470
CDS:
110..1255

Additional Resources:

NCBI RefSeq record:
NM_010909.4
NBCI Gene record:
Nfkbil1 (18038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010909.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067508 CTCAAGAATAGACGGAAGGAA pLKO.1 1292 3UTR 100% 3.000 4.200 N Nfkbil1 n/a
2 TRCN0000365864 TCAAGTGACCCTAGGGAATAA pLKO_005 1248 CDS 100% 13.200 9.240 N Nfkbil1 n/a
3 TRCN0000365865 AGCGATTCCGAAGCCAGATTG pLKO_005 1152 CDS 100% 10.800 7.560 N Nfkbil1 n/a
4 TRCN0000365940 AGTTTCCAAGGAGCGGGAATG pLKO_005 586 CDS 100% 6.000 4.200 N Nfkbil1 n/a
5 TRCN0000374214 CAAGAGGCTCAACGGGACAAA pLKO_005 905 CDS 100% 4.950 3.465 N Nfkbil1 n/a
6 TRCN0000067509 TGATGCTTACACGGACTTCTT pLKO.1 442 CDS 100% 4.950 3.465 N Nfkbil1 n/a
7 TRCN0000374213 AGGTACTTGAGAGTCCAACAG pLKO_005 1103 CDS 100% 4.050 2.835 N Nfkbil1 n/a
8 TRCN0000056816 GATTCCGAAGCCAGATTGAGA pLKO.1 1155 CDS 100% 3.000 2.100 N NFKBIL1 n/a
9 TRCN0000067510 GCAGCGATTCCGAAGCCAGAT pLKO.1 1150 CDS 100% 1.350 0.945 N Nfkbil1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010909.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.