Transcript: Mouse NM_011042.2

Mus musculus poly(rC) binding protein 2 (Pcbp2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pcbp2 (18521)
Length:
2829
CDS:
246..1295

Additional Resources:

NCBI RefSeq record:
NM_011042.2
NBCI Gene record:
Pcbp2 (18521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120931 TCCTGAGAGAATTATCACTTT pLKO.1 407 CDS 100% 4.950 6.930 N Pcbp2 n/a
2 TRCN0000328932 TCCTGAGAGAATTATCACTTT pLKO_005 407 CDS 100% 4.950 6.930 N Pcbp2 n/a
3 TRCN0000375062 GGCAATGCAACAGTCTCATTT pLKO_005 980 CDS 100% 13.200 9.240 N Pcbp2 n/a
4 TRCN0000336831 ACCACCTCTAGAGGCCTATAC pLKO_005 905 CDS 100% 10.800 7.560 N PCBP2 n/a
5 TRCN0000120930 GCAGCTCTATGACCAATAGTA pLKO.1 496 CDS 100% 5.625 3.938 N Pcbp2 n/a
6 TRCN0000328933 GCAGCTCTATGACCAATAGTA pLKO_005 496 CDS 100% 5.625 3.938 N Pcbp2 n/a
7 TRCN0000074683 CCATGATCCATCTGTGTAGTT pLKO.1 1334 3UTR 100% 4.950 3.465 N PCBP2 n/a
8 TRCN0000327906 CCATGATCCATCTGTGTAGTT pLKO_005 1334 3UTR 100% 4.950 3.465 N PCBP2 n/a
9 TRCN0000120929 GCACGTATCAACATCTCAGAA pLKO.1 378 CDS 100% 4.950 3.465 N Pcbp2 n/a
10 TRCN0000328864 GCACGTATCAACATCTCAGAA pLKO_005 378 CDS 100% 4.950 3.465 N Pcbp2 n/a
11 TRCN0000120928 GCAATCACTATTGCTGGCATT pLKO.1 678 CDS 100% 0.405 0.284 N Pcbp2 n/a
12 TRCN0000375061 TAGTCAGTGTGGCTCTCTTAT pLKO_005 563 CDS 100% 13.200 7.920 N Pcbp2 n/a
13 TRCN0000120927 CCCATCCATAATCCTGCTGTT pLKO.1 1307 3UTR 100% 4.050 2.430 N Pcbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.