Transcript: Mouse NM_011078.3

Mus musculus PHD finger protein 2 (Phf2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phf2 (18676)
Length:
5260
CDS:
121..3411

Additional Resources:

NCBI RefSeq record:
NM_011078.3
NBCI Gene record:
Phf2 (18676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218020 CATAGAATGTAGCGTGTAAAT pLKO_005 4362 3UTR 100% 13.200 18.480 N PHF2 n/a
2 TRCN0000104903 CCTGACATTGTGAAGAAACTA pLKO.1 745 CDS 100% 5.625 4.500 N Phf2 n/a
3 TRCN0000302905 CCTGACATTGTGAAGAAACTA pLKO_005 745 CDS 100% 5.625 4.500 N Phf2 n/a
4 TRCN0000104900 CGTGGCTATTAAAGTGTTCTA pLKO.1 5142 3UTR 100% 4.950 3.465 N Phf2 n/a
5 TRCN0000302986 CGTGGCTATTAAAGTGTTCTA pLKO_005 5142 3UTR 100% 4.950 3.465 N Phf2 n/a
6 TRCN0000104902 GAGCTGAAGATAGACGAGTTT pLKO.1 2161 CDS 100% 4.950 3.465 N Phf2 n/a
7 TRCN0000302903 GAGCTGAAGATAGACGAGTTT pLKO_005 2161 CDS 100% 4.950 3.465 N Phf2 n/a
8 TRCN0000104904 CACACTTAGTTCAAGGAGCTA pLKO.1 1298 CDS 100% 2.640 1.848 N Phf2 n/a
9 TRCN0000302904 CACACTTAGTTCAAGGAGCTA pLKO_005 1298 CDS 100% 2.640 1.848 N Phf2 n/a
10 TRCN0000104901 GCTGAAAGAATTCGTGGACTA pLKO.1 639 CDS 100% 0.000 0.000 N Phf2 n/a
11 TRCN0000302901 GCTGAAAGAATTCGTGGACTA pLKO_005 639 CDS 100% 0.000 0.000 N Phf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.