Transcript: Mouse NM_011156.2

Mus musculus prolyl endopeptidase (Prep), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Prep (19072)
Length:
2768
CDS:
118..2250

Additional Resources:

NCBI RefSeq record:
NM_011156.2
NBCI Gene record:
Prep (19072)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222513 GCACCAAGATTCCCATGTTTA pLKO.1 1457 CDS 100% 13.200 18.480 N Prep n/a
2 TRCN0000349146 GCACCAAGATTCCCATGTTTA pLKO_005 1457 CDS 100% 13.200 18.480 N Prep n/a
3 TRCN0000222514 CGAACCGCAATTCTCCCAATT pLKO.1 1028 CDS 100% 10.800 15.120 N Prep n/a
4 TRCN0000349147 CGAACCGCAATTCTCCCAATT pLKO_005 1028 CDS 100% 10.800 15.120 N Prep n/a
5 TRCN0000222517 CGGAATCCTGAAGTGGGTAAA pLKO.1 939 CDS 100% 10.800 15.120 N Prep n/a
6 TRCN0000316096 CGGAATCCTGAAGTGGGTAAA pLKO_005 939 CDS 100% 10.800 15.120 N Prep n/a
7 TRCN0000222515 GCAGGAGTATCATGGACATAA pLKO.1 165 CDS 100% 13.200 9.240 N Prep n/a
8 TRCN0000316064 GCAGGAGTATCATGGACATAA pLKO_005 165 CDS 100% 13.200 9.240 N Prep n/a
9 TRCN0000222516 CTTCTCAAATACTCGCCACTA pLKO.1 1948 CDS 100% 4.050 2.835 N Prep n/a
10 TRCN0000316066 CTTCTCAAATACTCGCCACTA pLKO_005 1948 CDS 100% 4.050 2.835 N Prep n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.