Transcript: Mouse NM_011159.2

Mus musculus protein kinase, DNA activated, catalytic polypeptide (Prkdc), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Prkdc (19090)
Length:
12674
CDS:
24..12410

Additional Resources:

NCBI RefSeq record:
NM_011159.2
NBCI Gene record:
Prkdc (19090)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361373 ACGTTGGACTCCAACTAATTA pLKO_005 7552 CDS 100% 15.000 21.000 N Prkdc n/a
2 TRCN0000368723 GCGCCGATCCGTGACTATAAA pLKO_005 11523 CDS 100% 15.000 21.000 N Prkdc n/a
3 TRCN0000361436 GTCGGGAACAGCGACATATTA pLKO_005 5314 CDS 100% 15.000 21.000 N Prkdc n/a
4 TRCN0000368722 TTTCGTCTAACCCGCCAATTT pLKO_005 11904 CDS 100% 13.200 18.480 N Prkdc n/a
5 TRCN0000023859 GCGACATATTATGGAAGAATT pLKO.1 5324 CDS 100% 0.000 0.000 N Prkdc n/a
6 TRCN0000023862 GCCATACAAATGTGGAATTAA pLKO.1 928 CDS 100% 15.000 10.500 N Prkdc n/a
7 TRCN0000023861 CCACCCAACAACAATATGATT pLKO.1 7921 CDS 100% 5.625 3.938 N Prkdc n/a
8 TRCN0000023860 CCAGCCTTAGACCTTCTGATT pLKO.1 399 CDS 100% 4.950 3.465 N Prkdc n/a
9 TRCN0000023863 GCTGCATACAACTGTGCCATT pLKO.1 5841 CDS 100% 4.050 2.835 N Prkdc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.