Transcript: Mouse NM_011175.3

Mus musculus legumain (Lgmn), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Lgmn (19141)
Length:
2023
CDS:
211..1518

Additional Resources:

NCBI RefSeq record:
NM_011175.3
NBCI Gene record:
Lgmn (19141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030995 CCTGAATAAGACTATTCGCTA pLKO.1 711 CDS 100% 0.264 0.211 N Lgmn n/a
2 TRCN0000315569 CCTGAATAAGACTATTCGCTA pLKO_005 711 CDS 100% 0.264 0.211 N Lgmn n/a
3 TRCN0000030996 CCCGAGATCATGTCTTCATTT pLKO.1 626 CDS 100% 13.200 9.240 N Lgmn n/a
4 TRCN0000308619 CCCGAGATCATGTCTTCATTT pLKO_005 626 CDS 100% 13.200 9.240 N Lgmn n/a
5 TRCN0000030998 CCATGGACAAAGTGTGTCTTA pLKO.1 1487 CDS 100% 4.950 3.465 N Lgmn n/a
6 TRCN0000308617 CCATGGACAAAGTGTGTCTTA pLKO_005 1487 CDS 100% 4.950 3.465 N Lgmn n/a
7 TRCN0000030997 CCTGACCATCTTGAAGAGGAA pLKO.1 1149 CDS 100% 2.640 1.848 N Lgmn n/a
8 TRCN0000308616 CCTGACCATCTTGAAGAGGAA pLKO_005 1149 CDS 100% 2.640 1.848 N Lgmn n/a
9 TRCN0000030994 CCATTAGCTTTCAAGAGCAAA pLKO.1 1765 3UTR 100% 4.950 2.970 N Lgmn n/a
10 TRCN0000308620 CCATTAGCTTTCAAGAGCAAA pLKO_005 1765 3UTR 100% 4.950 2.970 N Lgmn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.