Transcript: Mouse NM_011178.2

Mus musculus proteinase 3 (Prtn3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Prtn3 (19152)
Length:
983
CDS:
10..774

Additional Resources:

NCBI RefSeq record:
NM_011178.2
NBCI Gene record:
Prtn3 (19152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414832 GGAACTGAACGTCACGGTGGT pLKO_005 528 CDS 100% 0.720 1.008 N Prtn3 n/a
2 TRCN0000032683 GTCAGGTCTTCCAGAACAATT pLKO.1 323 CDS 100% 13.200 9.240 N Prtn3 n/a
3 TRCN0000032680 CCCTTGATCTGCAATGGCATT pLKO.1 631 CDS 100% 4.050 2.835 N Prtn3 n/a
4 TRCN0000420205 ACCCTGATCCACCCGAGATTC pLKO_005 190 CDS 100% 3.600 2.520 N Prtn3 n/a
5 TRCN0000032681 GAGAACCTCAATGACGTGCTT pLKO.1 355 CDS 100% 2.640 1.848 N Prtn3 n/a
6 TRCN0000032682 GCATTCTTCATGGAGTGGACT pLKO.1 647 CDS 100% 2.640 1.848 N Prtn3 n/a
7 TRCN0000032679 CCAGCAGGCTCTAGTGGGAAA pLKO.1 815 3UTR 100% 1.350 0.945 N Prtn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.