Transcript: Mouse NM_011195.2

Mus musculus pre T cell antigen receptor alpha (Ptcra), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ptcra (19208)
Length:
1283
CDS:
99..719

Additional Resources:

NCBI RefSeq record:
NM_011195.2
NBCI Gene record:
Ptcra (19208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246468 CAAACTGCTTCTGCTCGATGT pLKO_005 593 CDS 100% 4.050 5.670 N Ptcra n/a
2 TRCN0000246466 CCATCACACTGCTGGTAGATG pLKO_005 214 CDS 100% 4.950 3.960 N Ptcra n/a
3 TRCN0000257543 ACAGAATTTGGACATAGTTAT pLKO_005 703 CDS 100% 13.200 9.240 N Ptcra n/a
4 TRCN0000246465 CCTGGTAACTGGGCACAATAC pLKO_005 1031 3UTR 100% 10.800 7.560 N Ptcra n/a
5 TRCN0000246467 TCTGGTTCTCAGCTGGCAATG pLKO_005 301 CDS 100% 6.000 4.200 N Ptcra n/a
6 TRCN0000189775 GCTCCTCTTCAAACTGCTTCT pLKO.1 584 CDS 100% 4.050 2.835 N Ptcra n/a
7 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 1123 3UTR 100% 13.200 6.600 Y Ptcra n/a
8 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 1131 3UTR 100% 2.640 1.320 Y Adsl n/a
9 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 1131 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.