Transcript: Mouse NM_011202.3

Mus musculus protein tyrosine phosphatase, non-receptor type 11 (Ptpn11), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ptpn11 (19247)
Length:
5628
CDS:
183..1976

Additional Resources:

NCBI RefSeq record:
NM_011202.3
NBCI Gene record:
Ptpn11 (19247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029877 CGTGTTAGGAACGTCAAAGAA pLKO.1 1332 CDS 100% 5.625 7.875 N Ptpn11 n/a
2 TRCN0000327986 CGTGTTAGGAACGTCAAAGAA pLKO_005 1332 CDS 100% 5.625 7.875 N Ptpn11 n/a
3 TRCN0000029875 CCTGATGAGTATGCGCTCAAA pLKO.1 1296 CDS 100% 4.950 6.930 N Ptpn11 n/a
4 TRCN0000327984 CCTGATGAGTATGCGCTCAAA pLKO_005 1296 CDS 100% 4.950 6.930 N Ptpn11 n/a
5 TRCN0000029876 CTCGTATCAATGCTGCTGAAA pLKO.1 838 CDS 100% 4.950 6.930 N Ptpn11 n/a
6 TRCN0000327987 TTGAGACCAAGTGCAACAATT pLKO_005 1123 CDS 100% 13.200 9.240 N Ptpn11 n/a
7 TRCN0000029878 GACATCCTTATTGACATCATT pLKO.1 1611 CDS 100% 5.625 3.938 N Ptpn11 n/a
8 TRCN0000328059 GACATCCTTATTGACATCATT pLKO_005 1611 CDS 100% 5.625 3.938 N Ptpn11 n/a
9 TRCN0000029874 CCCTTGTAAGAAGAAAGGATT pLKO.1 2357 3UTR 100% 4.950 3.465 N Ptpn11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.