Transcript: Mouse NM_011204.2

Mus musculus protein tyrosine phosphatase, non-receptor type 13 (Ptpn13), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ptpn13 (19249)
Length:
8298
CDS:
351..7706

Additional Resources:

NCBI RefSeq record:
NM_011204.2
NBCI Gene record:
Ptpn13 (19249)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029010 CGGCTTATAAAGGTTAATGAT pLKO.1 5775 CDS 100% 5.625 7.875 N Ptpn13 n/a
2 TRCN0000029011 GCCTGCAAGAAGTATTTAGAA pLKO.1 442 CDS 100% 5.625 7.875 N Ptpn13 n/a
3 TRCN0000029013 CCAGGCAGAGTATGGAGATTA pLKO.1 2450 CDS 100% 13.200 9.240 N Ptpn13 n/a
4 TRCN0000029009 CCACCCGCAAAGAGAATGAAT pLKO.1 2176 CDS 100% 5.625 3.938 N Ptpn13 n/a
5 TRCN0000029012 CCTGCTCACATTCATCTCCTA pLKO.1 7412 CDS 100% 2.640 1.848 N Ptpn13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.