Transcript: Mouse NM_011227.1

Mus musculus RAB20, member RAS oncogene family (Rab20), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rab20 (19332)
Length:
722
CDS:
1..702

Additional Resources:

NCBI RefSeq record:
NM_011227.1
NBCI Gene record:
Rab20 (19332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380893 GCCGCTATCATCCTTACATAC pLKO_005 220 CDS 100% 10.800 15.120 N Rab20 n/a
2 TRCN0000102641 GCTATCATCCTTACATACGAT pLKO.1 223 CDS 100% 3.000 4.200 N Rab20 n/a
3 TRCN0000102642 CCTCCTCTTTGAAACCTTGTT pLKO.1 570 CDS 100% 4.950 3.960 N Rab20 n/a
4 TRCN0000380684 AGATCCTGAAGTACAAGATGC pLKO_005 476 CDS 100% 4.050 3.240 N Rab20 n/a
5 TRCN0000381012 AGAGGATGCAGTGGCCCTTTA pLKO_005 450 CDS 100% 10.800 7.560 N Rab20 n/a
6 TRCN0000102640 CCTGACAGAAACAGCCAACAA pLKO.1 291 CDS 100% 4.950 3.465 N Rab20 n/a
7 TRCN0000102644 GAAGATCCTGAAGTACAAGAT pLKO.1 474 CDS 100% 4.950 3.465 N Rab20 n/a
8 TRCN0000102643 CCCTTTACAAGAAGATCCTGA pLKO.1 464 CDS 100% 2.640 1.848 N Rab20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.