Transcript: Mouse NM_011250.4

Mus musculus RB transcriptional corepressor like 2 (Rbl2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rbl2 (19651)
Length:
4935
CDS:
120..3527

Additional Resources:

NCBI RefSeq record:
NM_011250.4
NBCI Gene record:
Rbl2 (19651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011250.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374158 TTGCAGAAATGCTCTACTATA pLKO_005 1591 CDS 100% 13.200 18.480 N Rbl2 n/a
2 TRCN0000379003 GCGCATTAGATTTAGTCTATG pLKO_005 802 CDS 100% 10.800 15.120 N Rbl2 n/a
3 TRCN0000435469 AGAACTTGTGAACCCTAATTT pLKO_005 851 CDS 100% 15.000 12.000 N Rbl2 n/a
4 TRCN0000379002 TAGCGATGATCTGGTCAATTC pLKO_005 764 CDS 100% 10.800 8.640 N Rbl2 n/a
5 TRCN0000071276 CCCTATATTAGGAAACTGTTT pLKO.1 1008 CDS 100% 4.950 3.960 N Rbl2 n/a
6 TRCN0000365867 CACTTCTGGAAACCCTATATT pLKO_005 996 CDS 100% 15.000 10.500 N Rbl2 n/a
7 TRCN0000365868 TGAATCCAGCAACTGATTAAA pLKO_005 3609 3UTR 100% 15.000 10.500 N Rbl2 n/a
8 TRCN0000071274 CGCTGACAGATTGAAAGAAAT pLKO.1 1487 CDS 100% 13.200 9.240 N Rbl2 n/a
9 TRCN0000071277 CCAGAACATCATGCGTTGTTA pLKO.1 2834 CDS 100% 5.625 3.938 N Rbl2 n/a
10 TRCN0000071275 GCTCTTCTTTAGAAAGGTTTA pLKO.1 2618 CDS 100% 10.800 6.480 N Rbl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011250.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.